Dna | Biology homework help


I. A embrace seacoast of DNA contains the aftercited continuity. 5’ AGTAGGTTTACACTGCTGCCCCACTATCGTATCTTCCCTGAGTGAGCATTG 3’

3’ TCATCCAAATGTGACGACGGGGTGATAGCATAGAAGGGACTCACTCGTAAC 5’

a. Write the 6 balbutiation produces and clump nucleotides in codons, i.e. GTACGT= GTA CGT.

b. From the 6 balbutiation produces, is there an known balbutiation produce (ORF)? If yes, which balbutiation produce? Please betoken the set-on-foot and plug codons in divergent varnishs.

 

II. Review bluish-unspotted screening in the webfooting below: http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html

 

You are cloning rational insulin gene (INS) in the lab using a plasmid, pJET, that contains an ampicillin hindrance marker and besides a lacZ gene interrupted by a multiple cloning footing. You transmute the rDNA into adapted E. coli cells by electroporation, then plated the transmuteed E. coli on agar plates containing ampicillin and X-Gal and waited one day until colonies are discernible. You then use bluish/unspotted screening to succor you authenticate clones that convey INS gene. You perceive-keep confused bluish and unspotted colonies on the agar plate.

 

a. What do bluish colonies represent? Briefly decipher your retort.

 

b. Which colonies (blue, unspotted, or twain) would you deficiency to select for exalt decomposition to restrain for the auspicious cloning of the INS gene? Briefly decipher your retort.

 

c. If you forgot to add X-gal to the agar preference moderation, how would the colonies that extend vary phenotypically from the ones that extend in plates after a while X-Gal? Briefly decipher your retort.

 

d. If you forgot to add ampicillin to the agar preference moderation, what other colonies would extend that won’t normally extend in plates after a while ampicillin? What varnish would those other colonies most slight be? Briefly decipher your retort